Showing posts with label DNA. Show all posts
Showing posts with label DNA. Show all posts

Just For Fun: DNA Scarf

If you're a knitting science teacher and are looking for a new project to kick off summer vacation, have I got one for you....

the DNA scarf! 

The pattern comes from Two Sheep, for free.  You do need to know how to cable (which really is easier than it looks), but other than that, it's a simple pattern. 

How fun would it be to wear your new scarf when you start talking DNA next school year?

And if you're not a knitter, maybe you know one whom you could appropriately bribe to make one for you!

DNA: Codon Bingo

Have your students fill in a blank Bingo card with amino acids - there aren't enough amino acids to fill a regular 5x5 card, so allow students to use each amino acid up to 2 times or use a smaller card.

Get 12 ping pong balls or practice golf balls.  Write A on three of them, C on three, G on three, and U on the last three.  Be careful... because the balls don't have an "up" side, C and U can look similar - you might want to put a line underneath each letter.  Place the ping pong balls into a bag or a hat.

Now play Bingo - pull 3 balls out of the bag, one at a time.  Have students translate those three letters into an amino acid and mark it on their Bing card if needed.

Return the balls to the bag, give it a shake and repeat.

You could write out all the 3 base combinations and pull them out of a bag, but I think the balls are more fun!   It would be even more fun if I could get my hands on one of those lottery/Bingo ball machines...

Comparing Amino Acids & DNA


A quick review...
DNA provides instructions for the assembly of amino acids into protein.

Therefore...
Similar proteins have a similar amino acid sequence.  And if the amino acid sequence is similar, the DNA is similar.

Scientists believe that similar DNA sequences indicate a common origin.

Hemoglobin (a protein in red blood cells) is one protein that has been studied in humans, gorillas, and horses.


Procedure:
Each group will be given 10 different colors of beads (each one representing a different amino acid - see list below).

Students use the beads to create the partial amino acid sequence for human, gorilla and horse hemoglobin (see below).

For assembly purposes, I give the students an index card with three pipe cleaners attached.  It keeps it all in one place, and it makes it easy for the students to compare the sequences at the end.

After students have completed the amino acid sequences, I use my keys to quickly check their work.
They then count and record the differences in the amino acid sequence.

From there, you can discuss...
--what determines the order of amino acids?
--where do we get our DNA from?
--where did our parents get their DNA from?
--random chnages in DNA occur over time, the mroe time passes, the more changes there will be.

At the end of the activity, students remove thier beads and return them to their appropriate bag.


The Amino Acid Sequences:
Human: gly lys val asp val asp glu val gly gly glu lys leu his val asp pro glu asp phe arg leu

Gorilla: gly lys val asp val asp glu val gly gly glu lys leu his val asp pro glu asp phe leu leu

Horse: asp lys val asp glu glu glu val gly gly glu lys leu his val asp pro glu asp phe arg leu

******
This activity comes from a wonderfully creative and talented teacher who presented it in a workshop at the New Jersey Science Teachers Association Convention.  Unfortunately, I don't have her name written down.  If you know her, or are her, please contact me and I will give her all the credit in the world for this great activity!

DNA: A Beaded Protein

Here's a fun way to test your students ability to translate DNA bases into amino acids...

I wrote out about 9 different strings of DNA bases (I just typed A, C, G, T at random).
For example:
ACTGTATGCTTGATGATGCGTAATGCTAGTTCCTGATGCTAGC

Each student was given one of the strands of DNA.  She then needed to determine the amino acids coded for by that DNA.

The student then went to a station where there were beads - one color for each amino acid. 

The appropriate beads were strung onto a length of lanyard lacing attached to an index card. 

After the amino acid sequence was complete, the student brought me the completed protein, which I quickly compared to my completed strands (pictured above).  It was quick and easy to check their work. 

I had students return the beads to the appropriate bags after they finished.  You could let yours turn their protein into a key chain, if you were so inclined. 

Turn Your Students Into a Protein

This one takes a little prep work the first time 'round.  But after that, you're set forever.  It's a great way to include a little kinesthetic activity into the study of DNA.

First, the prep work: 
On a long strip of paper* write out a string of DNA bases (actually, you're making the mRNA).  You want to make sure your letters are evenly spaced - I actually marked the paper.

Keep a codon chart handy - make sure you begin with a start codon and don't come to a stop codon immediately.  And, don't make the mistake of using T instead of U, as someone did...


Now you need to make a ribosome through which your strip of paper can fit.  I made mine out of fun foam.  It has magnets on the back, so it sticks to the white board.  Cut the window in the ribosome, so that you can see 3 bases at a time (hence the reason for evenly spacing your letters).  Use this picture to guide you:

Now you need to make the amino acids.  Once again I used fun foam.  I wrote the amino acid on the foam, punched holes in it and strung string through the holes so the students could wear them. 

For the activity: 
Draw a huge circle on the board - a cell.  Sketch in a nucleus and stick your ribosome in the middle as well. 

Show your students the mRNA (your paper strip) moving from the nucleus to the ribosome.

Feed the mRNA into the ribosome.

Have your students translate the first 3 mRNA bases into an amino acid.

Have a student put the appropriate amino acid placard on and stand in front of the room.

Move the mRNA to the next three bases.  Determine the amino acid.  Have another student put on the appropriate placard, then stand next to the first student and hold his/her hand.

Proceed this way until you come to a stop codon, or until you've made your point.

Your students will have a better feel for how a ribosome translates mRNA, how proteins are formed, and understand that proteins are long chains of amino acids. 

* I got a few sentence strips from an elementary teacher in my building - they're the perfect size and shape for this, I didn't have to cut them, and they have lines marked on them!

******
I learned this from a fellow teacher at a NJ Science Teachers Association Convention several years ago.  I don't know who that teacher is - but if you're out there, please let me know - I'd like to give you credit.